5′-Terminal chemical capping of spliced leader RNAs

Spliced leader (SL) RNA trans-splicing adds a N2,N2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5′ end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5′-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3′ biotin tag.

Graphical abstractDownload full-size image