| Article ID | Journal | Published Year | Pages | File Type |
|---|---|---|---|---|
| 9440223 | Research in Microbiology | 2005 | 8 Pages |
Abstract
A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5â²-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3â²) and a universal downstream probe Cy5 (5â²-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3â²), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65â°C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85±0.5 and 56â°C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.
Related Topics
Life Sciences
Immunology and Microbiology
Applied Microbiology and Biotechnology
Authors
Marwan Abu-Halaweh, J. Bates, Bharat K.C. Patel,
