| Article ID | Journal | Published Year | Pages | File Type |
|---|---|---|---|---|
| 10772275 | Biochemical and Biophysical Research Communications | 2005 | 9 Pages |
Abstract
The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded β-lactamase is deduced. The β-lactamase encoded by the ampC gene has a calculated Mr 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the β-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has Mr 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A β-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is âufo-R&R-ampCâ, the genes running in the opposite directions. Functional analysis elicits that R&R[ampC] does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is â26 C upstream of the start codon; the P[I]-promoter should be the promoter response for the gene expression. Analysis of the R&R[ampC] elicits that the upstream activator binding sequence ΣUAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N8-12-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.
Keywords
Related Topics
Life Sciences
Biochemistry, Genetics and Molecular Biology
Biochemistry
Authors
Juey-Wen Lin, Shu-Fen Weng, Yuh-Fen Chao, Yi-Ting Chung,
