کد مقاله | کد نشریه | سال انتشار | مقاله انگلیسی | نسخه تمام متن |
---|---|---|---|---|
9200915 | 1189422 | 2005 | 4 صفحه PDF | دانلود رایگان |
عنوان انگلیسی مقاله ISI
Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE
دانلود مقاله + سفارش ترجمه
دانلود مقاله ISI انگلیسی
رایگان برای ایرانیان
کلمات کلیدی
موضوعات مرتبط
علوم زیستی و بیوفناوری
علم عصب شناسی
علوم اعصاب تکاملی
پیش نمایش صفحه اول مقاله

چکیده انگلیسی
We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).
ناشر
Database: Elsevier - ScienceDirect (ساینس دایرکت)
Journal: Neuromuscular Disorders - Volume 15, Issue 11, November 2005, Pages 775-778
Journal: Neuromuscular Disorders - Volume 15, Issue 11, November 2005, Pages 775-778
نویسندگان
A. Blazquez, M.A. MartÃn, M.C. Lara, R. MartÃ, Y. Campos, A. Cabello, R. Garesse, J. Bautista, A.L. Andreu, J. Arenas,