کد مقاله | کد نشریه | سال انتشار | مقاله انگلیسی | نسخه تمام متن |
---|---|---|---|---|
5275380 | 1385532 | 2012 | 5 صفحه PDF | دانلود رایگان |
عنوان انگلیسی مقاله ISI
5â²-Terminal chemical capping of spliced leader RNAs
دانلود مقاله + سفارش ترجمه
دانلود مقاله ISI انگلیسی
رایگان برای ایرانیان
موضوعات مرتبط
مهندسی و علوم پایه
شیمی
شیمی آلی
پیش نمایش صفحه اول مقاله
![عکس صفحه اول مقاله: 5â²-Terminal chemical capping of spliced leader RNAs 5â²-Terminal chemical capping of spliced leader RNAs](/preview/png/5275380.png)
چکیده انگلیسی
Spliced leader (SL) RNA trans-splicing adds a N2,N2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5â² end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5â²-terminal capped MMG and TMG wild-type, and mutant 22Â nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3â² biotin tag.
ناشر
Database: Elsevier - ScienceDirect (ساینس دایرکت)
Journal: Tetrahedron Letters - Volume 53, Issue 36, 5 September 2012, Pages 4843-4847
Journal: Tetrahedron Letters - Volume 53, Issue 36, 5 September 2012, Pages 4843-4847
نویسندگان
Karolina Piecyk, Richard E. Davis, Marzena Jankowska-Anyszka,