کد مقاله | کد نشریه | سال انتشار | مقاله انگلیسی | نسخه تمام متن |
---|---|---|---|---|
10755997 | 1050379 | 2014 | 5 صفحه PDF | دانلود رایگان |
عنوان انگلیسی مقاله ISI
Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)
دانلود مقاله + سفارش ترجمه
دانلود مقاله ISI انگلیسی
رایگان برای ایرانیان
کلمات کلیدی
موضوعات مرتبط
علوم زیستی و بیوفناوری
بیوشیمی، ژنتیک و زیست شناسی مولکولی
زیست شیمی
پیش نمایش صفحه اول مقاله
![عکس صفحه اول مقاله: Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)](/preview/png/10755997.png)
چکیده انگلیسی
The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K+ ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
ناشر
Database: Elsevier - ScienceDirect (ساینس دایرکت)
Journal: Biochemical and Biophysical Research Communications - Volume 447, Issue 1, 25 April 2014, Pages 128-132
Journal: Biochemical and Biophysical Research Communications - Volume 447, Issue 1, 25 April 2014, Pages 128-132
نویسندگان
Zoë A.E. Waller, Lesley A. Howell, Colin J. MacDonald, Maria A. O'Connell, Mark Searcey,