Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevancePhyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India.Aim of the studyTo assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools.Materials and methodsSamples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0.ResultsMorphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.ConclusionOur results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Species admixtures are a common problem in raw drug trade, often reducing the efficacy of the drug. In India, Phyllanthus (Euphorbiaceae) a traditionally well known hepato-protective plant is traded as raw herbal drug. In this study, we assess the species admixtures in raw drug trade of Phyllanthus in southern India using morpho-taxonomical characters and molecular analysis. The morphological analysis of these samples revealed six different species of Phyllanthus. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. Species specific DNA barcode signatures were developed for Phyllanthus species using the chloroplast DNA region, psbA-trnH. The trade sample identities were validated and confirmed by these species specific DNA barcodes.Figure optionsDownload as PowerPoint slide